bamhi sali sites (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
99
Structured Review
TaKaRa
bamhi sali sites
Bamhi Sali Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 14709 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sali+sites/BamH+I/pmc13099474-168-20-24
Average 99 stars, based on 14709 article reviews
Bamhi Sali Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 14709 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sali+sites/BamH+I/pmc13099474-168-20-24
Average 99 stars, based on 14709 article reviews
bamhi sali sites - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Amplification:Article Title: Taperin bundles F-actin at stereocilia pivot points enabling optimal lifelong mechanosensitivity. Article Snippet: The EGFP-Tprn full-length (RefSeq: NM_175286.4) and corresponding cDNA constructs of Tprn fragments used in our gene gun transfection experiments were PCR amplified from postnatal day 5 mouse inner ear cDNA using LA Taq DNA polymerase (Takara Mirus), cloned into XL-TOPO vector (Invitrogen), and transformed into DH5α E. coli strain (Invitrogen). .. A 2,250-bp cDNA product encoding the Tprn open reading frame was amplified with Pfu Ultra DNA polymerase (Stratagene) and ligated into the EcoRI and Article Title: Overexpression in Plasmodium falciparum of an intrinsically disordered protein segment of Pf UT impairs the parasite's proteostasis and reduces its growth rate. Article Snippet: .. Then, the amplified gene was cloned using the In-Fusion system into the BamHI and Article Title: Taperin bundles F-actin at stereocilia pivot points enabling optimal lifelong mechanosensitivity Article Snippet: pAAV-CAG-tdTomato plasmid used to purify AAV-expressing tdTomato was obtained from the Addgene (59462). .. A 2,250-bp cDNA product encoding the Tprn open reading frame was amplified with Pfu Ultra DNA polymerase (Stratagene) and ligated into the EcoRI and Plasmid Preparation:Article Title: Taperin bundles F-actin at stereocilia pivot points enabling optimal lifelong mechanosensitivity. Article Snippet: The EGFP-Tprn full-length (RefSeq: NM_175286.4) and corresponding cDNA constructs of Tprn fragments used in our gene gun transfection experiments were PCR amplified from postnatal day 5 mouse inner ear cDNA using LA Taq DNA polymerase (Takara Mirus), cloned into XL-TOPO vector (Invitrogen), and transformed into DH5α E. coli strain (Invitrogen). .. A 2,250-bp cDNA product encoding the Tprn open reading frame was amplified with Pfu Ultra DNA polymerase (Stratagene) and ligated into the EcoRI and Article Title: Overexpression in Plasmodium falciparum of an intrinsically disordered protein segment of Pf UT impairs the parasite's proteostasis and reduces its growth rate. Article Snippet: .. Then, the amplified gene was cloned using the In-Fusion system into the BamHI and Article Title: Development of DNA Aptamers Against Leishmania infantum GP63 Protein for Therapeutic and Diagnostic Applications. Article Snippet: The region encoding the mature form of L. infantum GP63-2 (LiGP63m, LINF_100010200), spanning residues Val97 to Asn574 of the full-length protein, was PCR-amplified from genomic DNA extracted from a L. infantum culture with the DNeasy® Blood & Tissue kit (Qiagen, Venlo, The Netherlands), according to the manufacturer’s protocol. .. The selected primers (forward: 5′GAAGGTCGTGGGATCGTCGTGCGCGCCGCGAACTGG3′, reverse: 5′GGCCGCTCGAGTCGAGTTGCCGCCGTCCTTGGC3′) allowed the seamless cloning of the gene into the BamHI and Article Title: Nucleotide composition shapes gene expression in Wolbachia pipientis : a role for MidA methyltransferase? Article Snippet: .. The w Oo SAM-dependent mid A gene was artificially synthesized with codon usage optimized (performed by Eurofins Scientific company) and cloned into the XhoI and Article Title: Taperin bundles F-actin at stereocilia pivot points enabling optimal lifelong mechanosensitivity Article Snippet: pAAV-CAG-tdTomato plasmid used to purify AAV-expressing tdTomato was obtained from the Addgene (59462). .. A 2,250-bp cDNA product encoding the Tprn open reading frame was amplified with Pfu Ultra DNA polymerase (Stratagene) and ligated into the EcoRI and Clone Assay:Article Title: Overexpression in Plasmodium falciparum of an intrinsically disordered protein segment of Pf UT impairs the parasite's proteostasis and reduces its growth rate. Article Snippet: .. Then, the amplified gene was cloned using the In-Fusion system into the BamHI and Article Title: Nucleotide composition shapes gene expression in Wolbachia pipientis : a role for MidA methyltransferase? Article Snippet: .. The w Oo SAM-dependent mid A gene was artificially synthesized with codon usage optimized (performed by Eurofins Scientific company) and cloned into the XhoI and Article Title: The histone acetyltransferase GCN5 regulates floral meristem activity and flower development in Arabidopsis. Article Snippet: The histone acetyltransferase (HAT) GENERAL CONTROL NON DEREPRESSIBLE5 (GCN5) participates in various developmental processes in Arabidopsis (Arabidopsis thaliana).. Notably, GCN5 ensures proper flower development, but the underlying mechanism remains unknown.. Here, we show that during early flower development, GCN5 catalyzes histone acetylation at WUSCHEL (WUS) and CLAVATA3 (CLV3) chromatin, activating their expression. other:Article Title: Herpes simplex virus 1 evades APOBEC1-mediated immunity via its uracil-DNA glycosylase in mice. Article Snippet: Herpes simplex virus 1 (HSV-1) is the most common cause of viral encephalitis, which can be lethal or result in severe neurological defects despite antiviral therapy.. The apolipoprotein B messenger-RNA editing enzyme, catalytic polypeptide-like (APOBEC) group of proteins can act as viral restriction factors.. How HSV-1 evades this intrinsic immune mechanism is unclear. Cloning:Article Title: Development of DNA Aptamers Against Leishmania infantum GP63 Protein for Therapeutic and Diagnostic Applications. Article Snippet: The region encoding the mature form of L. infantum GP63-2 (LiGP63m, LINF_100010200), spanning residues Val97 to Asn574 of the full-length protein, was PCR-amplified from genomic DNA extracted from a L. infantum culture with the DNeasy® Blood & Tissue kit (Qiagen, Venlo, The Netherlands), according to the manufacturer’s protocol. .. The selected primers (forward: 5′GAAGGTCGTGGGATCGTCGTGCGCGCCGCGAACTGG3′, reverse: 5′GGCCGCTCGAGTCGAGTTGCCGCCGTCCTTGGC3′) allowed the seamless cloning of the gene into the BamHI and Article Title: The histone acetyltransferase GCN5 regulates floral meristem activity and flower development in Arabidopsis. Article Snippet: The histone acetyltransferase (HAT) GENERAL CONTROL NON DEREPRESSIBLE5 (GCN5) participates in various developmental processes in Arabidopsis (Arabidopsis thaliana).. Notably, GCN5 ensures proper flower development, but the underlying mechanism remains unknown.. Here, we show that during early flower development, GCN5 catalyzes histone acetylation at WUSCHEL (WUS) and CLAVATA3 (CLV3) chromatin, activating their expression. Synthesized:Article Title: Nucleotide composition shapes gene expression in Wolbachia pipientis : a role for MidA methyltransferase? Article Snippet: .. The w Oo SAM-dependent mid A gene was artificially synthesized with codon usage optimized (performed by Eurofins Scientific company) and cloned into the XhoI and Expressing:Article Title: Nucleotide composition shapes gene expression in Wolbachia pipientis : a role for MidA methyltransferase? Article Snippet: .. The w Oo SAM-dependent mid A gene was artificially synthesized with codon usage optimized (performed by Eurofins Scientific company) and cloned into the XhoI and Generated:Article Title: PtdSer as a signaling lipid determined by privileged localization of ORP5 and ORP8 at ER/PM junctional foci to determine PM and ER PtdSer/PI(4)P ratio and cell function Article Snippet: The siORP5 (cat # L-009274-01-0010) and siORP8 (cat #L-009508-000010) were obtained from Horizon discovery, tested by PCR and western blots. .. CFP-evt2-2xPH was generated by inserting the evt2-2xPH fragment of GFP-evt2-2xPH into the BglII and |